141. Microbiology ETHZ Translate this page http://www.micro.biol.ethz.ch/

142. Lyme Disease, Division Of Microbiology And Infectious Diseases The National Institutes of Health (NIH), National Institute of Allergies and Infectious Diseases (NIAID), Division of microbiology and Infectious Diseases (DMID) presents information on Lyme disease in the following categories Introduction, Extramural Research Projects and Clinical Studies, Conference Proceedings, Brochures, News Releases, Fact Sheets, Research Plans and Priorities, Opportunities and Resources, Intramural Research Projects, Meetings. http://www.niaid.nih.gov/dmid/lyme/

Lyme Disease NIAID Research on Lyme Disease Introduction General Information Extramural Research Projects and Clinical Studies ... Related Links Introduction Lyme disease is an infection caused by the corkscrew-shaped bacteria Borrelia burgdorferi that are transmitted by the bite of deer ticks (Ixodes scapularis) and western black-legged ticks (Ixodes pacificus). The deer tick, which normally feeds on the white-footed mouse, the white-tailed deer, other mammals, and birds, is responsible for transmitting Lyme disease bacteria to humans in the northeastern and north-central United States. On the Pacific Coast, the bacteria are transmitted to humans by the western black-legged tick. Top of Page General Information Extramural Research Projects and Clinical Studies NIH Chronic Lyme Disease Treatment Study Protocol , (Phase III Clinical Study) Seronegative Chronic Lyme Disease , (Phase III Clinical Study) Seropositive Chronic Lyme Disease , (Phase III Clinical Study) NIAID's Chronic Lyme Disease Study: Questions and Answers Reliability of Blood and Urine Tests for Lyme Disease Lyme Disease Advisory Panel Summary Report (Sept. 4, 1996)

143. Inter-Research - Marine Ecology Progress Series serves as a worldwide forum for all aspects of marine ecology, fundamental and applied. The journal covers microbiology, botany, zoology, ecosystem research, biological oceanography, ecological aspects of fisheries and aquaculture, pollution, environmental protection, conservation, resource management. Published by John Wiley Sons. http://www.int-res.com/journals/meps/index.html

Inter-Research Marine Ecology Progress Series IR Home MEPS Home Editors Forthcoming Information Subscribe Journals Home MEPS AME CR DAO ESEP ... Subscribe Book Series EE Books Top Books ESEP Books Order EEIU Brochures (pdf format) Discussion Forums Home Research IR Research Institutions International Ecology Institute Eco-Ethics International Union Foundation Otto Kinne Foundation Publication schedules 2003: 20 volumes, 246 to 265 2004: 20 volumes, 266 to 285 Annual rate (upgraded subscription including both print and online versions) Euro 3460 plus postage MEPS Subscribe Online MEPS Information MEPS Editorial Staff Guidelines for MEPS Authors ... Forthcoming Publications Most recent volumes: Volume 272 published on May 19, 2004 CPR Plankton Atlas Print version: ISSN 0171-8630; Online version: ISSN 1616-1599 Annual Publication Program We have decided to publish not more than 20 volumes per year and that there will be no increases in the annual subscription rate for the foreseeable future. Tables of contents with abstracts: (abstracts and full articles in pdf format are added on the day of publication) CPR Plankton Atlas This page was last updated on 19 May 2004.

144. Welcome To The Department Of Microbiology The faculty of the Department of microbiology carry out multidisciplinary research programs in microbial genetics, pathogenesis, immunology, and virology. http://www.microbio.uab.edu/

If you have questions, concerns, or comments about this site, please contact Cindy Pratt Other Links Check Your Email Help Desk Other Sites of Interest Faculty/Administrators Centers and Core Facilities Department Phone List For More Information FastCounter by bCentral UAB Home Microbiology Home Faculty ... Retreat Highlights The faculty of the Department of Microbiology carry out multi-disciplinary research programs in microbial genetics, pathogenesis, immunology, and virology. The Department of Microbiology has 41 primary faculty and more than $16 million in active NIH grant support. It is one of eight Joint Health Science Departments at UAB. Departmental dedication to excellence in research, teaching, and training is evidenced not only by our funding support, but also by our ability to attract outstanding postdoctoral fellows and graduate students. We train approximately thirty postdoctoral and seventy-five graduate students at any given time and take pride in launching our trainees into successful and productive careers. You can stop the scroller by clicking anywhere on the text.

145. Department Of Microbiology And Immunology The Department of microbiology and Immunology at The UND School of Medicine and Health Sciences welcomes you to our home page. Please http://www.med.und.nodak.edu/bimd/micro.html

text only The Department of Microbiology and Immunology at The UND School of Medicine and Health Sciences welcomes you to our home page. Please follow the links above or to the left to find out more about our department, the Medical School at UND, or Grand Forks. Feel free to contact us if you have any questions. MBIO 302 DEPARTMENT HEAD Roger Melvold University of North Dakota School of Medicine and Health Sciences Department of Microbiology and Immunology 501 North Columbia Road Grand Forks, ND 58203 DIRECTOR OF GRADUATE STUDY Kevin Young University of North Dakota School of Medicine and Health Sciences Department of Microbiology and Immunology 501 North Columbia Road Grand Forks, ND 58203

146. An Old Plague Coming Back To Haunt Us.: Diphtheria: What Is That - Suite101.com Approximately 1200 deaths per year have resulted from the ongoing diphtheria epidemic in the former Soviet Union which began in 1990 and is still going strong. http://www.suite101.com/article.cfm/microbiology/1667

Topics Articles Links Courses DIRECTORY COMMUNITIES BOOK CIRCLE SUITE U ... MY SUITE Search Suite101.com Within: Microbiology Environment Search The Web Member Central Join Our Community! Login What's New Become a SuiteU Affiliate ... MemberUpdate Suite University About Suite University Suite University News Visit the University Course Listing ... FREE Demo Course New Topics Attachment Parenting A Day in the Life LDS Family Humor Beginning Organic Gardening ... More... Suite Events Fibromyalgia: Fighting Invisibility Teacher Appreciation Event 2004 Family Focus 2004 In Tune With Johann Sebastian Bach More about Suite101 About Suite101.com - Select a related topic - Aquatic Animals Arctic Wildlife Backyard Birdwatching Alm Birding Ecology Living With Nature Living with Wildlife Lizards, Turtles and Snak Massachusetts Natural His Microbiology Natural Horsemanship Paleontology Science of the Sky Snails and Shells Water for Life Wild Cats Wildlife Wildlife News and Humor - Select a related course - Ecological Gardening: Org Environmental affairs - G Environmental Health Issu Inspecting For Wildlife D Our National Wildlife Tre Trap-Neuter-Return: Manag Visit Environment Detailed Topic List Home Science and mathematics ... Microorganisms, fungi, algae

147. Brazilian Journal Of Microbiology - Home Page Translate this page Brasileira de Microbiologia Mission To publish original research papers, research notes and, occasionally, reviews, covering all aspects of microbiology. http://www.scielo.br/scielo.php?script=sci_serial&pid=1517-8382&lng=en&nrm=iso

148. Weiterleitung covers the entire field of marine botany including marine microbiology and marine mycology. Its purpose is to disseminate original knowledge, to provide synopses of global or interdisciplinary interest, and to stress aspects of utilization. Published by Walter de Gruyter. http://www.degruyter.de/journals/bm/index.html

149. Journal Of Medical Microbiology -- Home Society for General microbiology HighWire Press The Society for General microbiology publishes Journal of Medical microbiology Online with the assistance of http://jmm.sgmjournals.org/

Instructions for Authors Submit Online Subscriptions Free Sample Issue ... The Society for General Microbiology publishes Journal of Medical Microbiology Online with the assistance of HighWire Press ONLINE SUBMISSION IS NOW COMPULSORY AS OF 1 MARCH 2004 View Future Titles Through July 2004 Select an Issue from the Archive August 1968 - June 2004 Search for Articles August 1968 - June 2004 Collected Papers Editorials Review articles Case reports Correspondence Browse Articles Most-read articles Most-cited articles Supplementary data Quick Search advanced Author: (e.g., Smith, JS) Keyword(s): Year: Vol: Page: Current Issue: June 2004 (Next: June 21) INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL ALL SGM JOURNALS ... http://intl-jmm.sgmjournals.org Australia, Brazil, China, France, Germany, Hong Kong, Ireland, Israel, Italy, Japan, Mexico, Russia, Singapore, South Africa, South Korea, Spain, Sweden, Switzerland, Taiwan, The Netherlands, UK. (More Information) Society for General Microbiology Online ISSN: 1473-5644 Print ISSN: 0022-2615

150. CELLS Alive! Good general microbiology information, with images and videos. http://www.cellsalive.com/

Home Quill Graphics Contents..... Cell Biology Microbiology Immunology Microscopy Interactive..... Plant Cell Animal Cell Mitosis Cell Cycle ... Take a Quiz Get..... Stock Video the CDROM Clip Downloads Animations Galleries..... Cell Gallery Crystal Gallery Study Tools Index Search Translate Homework ... Links Site Information..... Permission Privacy About Us Awards ... Contact for Producers Download Videos CELLS alive! CDROM Red Blood Cells A human red cell has no nucleus and is responsible for carrying oxygen to the tissues.

151. Conserved Cis-acting Sequences. Filoviridae Conserved cisacting sequences of RNA viruses as antiviral drug targets. http://www.microbiology.wustl.edu/dept/fac/huang/ccas/ccas/fil

(Return to Main) CONSERVED CIS-ACTING SEQUENCES OF RNA VIRUSES Filoviridae Single-stranded, minus-sense RNA genome Sequences shown here are those of the genomic minus-strand RNA Filovirus e.g. , Marburg virus (MBG) , Ebola virus (EBO). Conserved terminal sequences of genomic RNAs [e.g., Kiley, et al., 1986 5' end 3' end Marburg (Musoke) GGACACACAAAAAAGAUGAAGAA...AUCAUCUCUUGUUUUUGUGUGUCU MVREPCYC Z12132 Ebola (Mayinga) UA-AU-...UC-UCUCCG 5' and 3' ends are invert repeats, that potentially form panhandle structures, probably recognized for replication, transcription or packaging. e.g., Marburg virus: 5' end GGACACACA AAAAA GAUGAAGAAUGUUUUGUGUUACUUAUAUCAAAGCU_ MVREPCYC Z12132 Some similarity (conservation?) of the termini of the genomic RNA of Sendai virus (Paramyxoviridae), VSV (Rhabdoviridae) and Marburg virus (Filoviridae) 5' end 3' end Sendai ACC AGACAAGAGUUUAAGA.....UUUUUCUCUUGUUU GGU PAFZSTR M30202 VSV GAC-C-AAACC-.....-GGUGUC-UC VSVCG J02428 MBG GGAC-C-AA-AGAUG-AG.....-CGU-UG-GUC-

152. RSSL Science With Service Research, analysis and consultancy for the food, drink and consumer goods industries including microbiology, vitamin analysis, natural products, chemical testing and GMOs. http://www.rssl.com/

Parents report that colours and preservatives do affect children Numerous UK media sources report on work carried out by scientists at the University of Southampton, under the leadership of Professor John Warner. They appear to confirm the notion that certain artificial colours and the preservative, more... RSSL is an independent global leader at the forefront of scientific analysis, product testing, product development, training and consultancy. We serve the food, pharmaceutical, and consumer goods industries. We offer industry leading customer service coupled with scientific excellence. Health, obesity and well-being (HOW) service RSSL has launched a range of services that are designed to tackle many of the consumer health, obesity and well-being (HOW) issues that are currently at the forefront of the food industry. The HOW package of services includes glycemic index (GI) testing of foods and reformulation of products to achieve a lower GI. The services are designed to give manufacturers the opportunity to provide consumers with the healthiest possible version of any product. RSSL launches Glycemic Index service.

153. Molecular And Cell Biology Dept Redirect Page An exhaustive list of news links about all aspects of ebola, provided by Dr. Ed Rybicki. http://www.uct.ac.za/microbiology/ebopage.html

The new address for the Ebola page is http://www.uct.ac.za/microbiology/ebola/ebopage.htm Please change your bookmarks You will be automatically redirected to the new location in 10 seconds.

154. Water Testing, Food Microbiology And Pharmaceutical Microbiology - PMS Offers water testing, food microbiology, and pharmaceutical microbiology in UKAS accredited laboratories. Located in Middleton, England. http://www.pathology-management.co.uk/

Water Testing, Food Microbiology and Pharmaceutical Microbiology For the Food Industry: UKAS (previously NAMAS) Accredited food testing to ensure food safety including; HACCP (Hazard analysis critical control point), Bacterial tests to exclude Salmonella, Listeria, E.coli, Staph aureus, and other food pathogens Rose Mill Union Street Middleton Manchester TEL: 0161 643 53 FAX: 0161 653 3647 Shelf Life Testing: Total Viable Counts Coliform Counts Enterobacteriaceae Clostridium perfringens Enterococci (faecal streptococci) Yeasts Moulds Staphylococcus aureus For the Water Treatment Industry: All water microbiology for drinking water standards and EC Directives. Microbiology testing, bacteria testing of potable water supplies and other waters including cooling towers. Total Viable Counts, TVCs, plus Coliforms and E.coli by membrane filtration. Swimming pools, spa pools, jacuzzi also tested for Pseudomonas, faecal streptococci,Clostridium perfringens. Legionella testing and legionella risk assessment performed. Dip slides supplied. Environmental Testing: Hygiene testing, hygiene consultancy, environmental swabs, settle plates, slit sampling for air microbiology also available.

155. Microbiology Textbook :: The World Of Microbes Timothy Paustian from the University of WisconsinMadison has created an excellent microbiology textbook. http://www.bact.wisc.edu/microtextbook/index.html

@import url("themes/Microtextbook/style/style.css"); Search Textbook Table of Contents Bacterial Structure Bacterial Growth Control of Growth Bacterial Nutrition ... Metabolism Main Menu Home Site sections FAQ News Search Sections ... Web Links Online We have 5 guests and members online Welcome Guest, become a member today. CWD is unlikely to be transmitted to humans Posted by paustian on Wednesday, May 26, 2004 - 10:34 AM; Science News A recent study by the CDC shows that chronic wasting disease (CWD) in deer and elk is unlikely to be transmitted to humans. CWD is a prion disease, similar to mad cow disease and Creutzfeldt-Jakob disease (CJD) in humans. This conclusion was based upon epidemiological studies that showed a normal instance of CJD in areas that are endemic for CWD. Researchers also performed in vitro experiments examining the ability of the CWD prion protein to convert the normal healthy human prion protein to its diseased form. The rate of conversion was 14-fold lower than that for conversion of healthy deer prions to the diseased form. An conversion rate this low is not going to be able to cause disease in humans. This strongly suggests that transmission of CWD to humans is very unlikely. comments?

156. The Ebola And Marburg Virus Includes Genomic Structure, Comparative and Molecular Biology http://www.uct.ac.za/microbiology/ebolagen.html

157. Graduate (Ph.D.) Program In Immunology, Microbiology, And Vaccine Biology At The The graduate program provides predoctoral training and Ph.D. research opportunities and has ties with 11 departments and centers. http://www.urmc.rochester.edu/gebs/imv/index.html

News ' New research on deadly flu viruses IMV Homepage Welcome PhD Student Class, 2004 PhD Student Class, 2003 ... Graduate Studies Homepage Graduate Program in Immunology, Microbiology and Vaccine Biology The Graduate Program in Immunology, Microbiology and Vaccine Biology is an integrated graduate program that provides predoctoral training and Ph.D. research opportunities in the areas of Immunology, Microbiology and Vaccine Biology. This graduate program is based at the University of Rochester Medical Center (Rochester, New York) and it is administered principally by faculty from the Department of Microbiology and Immunology and the Center for Vaccine Biology and Immunology . Other participating Departments and Centers include the Departments of Biochemistry and Biophysics, Chemical Engineering, Dermatology, Medicine, Obstetrics and Gynecology, Pediatrics and Psychiatry, the Center for Oral Biology and the University of Rochester Cancer Center. This doctoral program seeks to provide an outstanding training environment for the predoctoral education of the next generation of immunologists and microbiologists who will be working in academic institutions, industry, government laboratories and private research foundations. This environment includes: outstanding Ph.D. research opportunities; concerned, skilled, and interactive research mentors whose research addresses a wide diversity of scientific questions; state-of-the art research facilities; newly redesigned graduate level lecture courses; advanced topical seminars; and opportunities to attend and actively participate in scientific meetings providing a wide range of faculty expertise and research opportunities.

158. Bugs In The News! John (Jack) C. Brown from the University of Kansas, Lawrence, Kansas has created great microbiology site. It contains a What the Heck is ? , a general interest, and other bug bytes sections. Good information. http://people.ku.edu/~jbrown/bugs.html

Bugs in the News! ~~~ Feature Articles ~~~ What the Heck is Mad Cow Disease? ~ Articles ~ For the Curious.... What the Heck is..... General Interest..... More Bug Bytes..... Books Don't Touch That Doorknob! How Germs Can Zap You and How You Can Zap Back , Warner Books, Publisher, publication date, October 1, 2001 was written by me and Edited by Dinah Dunn of Byron Preiss Visual Publications, New York and Jackie Merri Meyer of Warner Books. Available on-line and at bookstores, the book provides information on microorganisms associated with foodborne illness, colds and flu, day care, hospitals, travel, pets, home, work and those that may be used as an agent for biological warfare. All of the "Feature Articles," and the articles in "What the Heck is...?" and in "General Interest" were written by me, and therefore, any mistakes are mine, alone. I have tried to be as accurate as possible within the limits of providing the information in a "reader-friendly" format. Therefore, please forgive any latitude I have taken with the pure science discussed. With these caveats in mind: in keeping with the spirit of the "Web" and Internet, and the fact that this institution has been established for, and is devoted to, learning, all of the articles on these Pages are for anyone's use, as long as the use is for non-profit only, and this statement accompanies any copies.

159. Undergraduate Program In Biology And Medicine For undergraduate students, degree concentrations include biochemistry, biology, cell and developmental biology, ecology and evolutionary biology, microbiology, molecular genetics, and neuroscience. http://www.rochester.edu/College/BIO/UPBM/index.html

A collaborative effort between the College of Arts and Sciences and the School of Medicine and Dentistry for undergraduate education in the Biological Sciences. An exciting program in the Biological Sciences is available to undergraduate students at the University of Rochester. The Program combines the College of Arts and Sciences and the School of Medicine and Dentistry to provide courses for undergraduate students with lectures, laboratory work, specialty seminars and research experiences. The Program provides academic year opportunities to do independent research for credit as well as DeKiewiet Summer Fellowships which support summer research by outstanding University of Rochester undergraduate students. The Program is made possible by the close proximity of the Medical Center and the River Campus and by the enthusiasm of the faculty for cooperative teaching aimed at providing the most up-to-date education in biomedical science. Last modified: November 15, 2001.

160. Joint & Specialized Degree Programs The Simon School offers a variety of specialized degrees in conjunction with the Department of Anesthesiology, the Department of microbiology and Immunology, the School of Nursing, the Department of Community and Preventive Medicine, and the M.D. Program at the School of Medicine and Dentistry. http://www.ssb.rochester.edu/programs/program_joint.aspx

- Quick Links - About Simon Full-Time M.B.A. Part-Time M.B.A. Executive M.B.A. MS Programs Certificate Program Ph.D. Programs Corporate Partners Faculty Research Accepted Students Prospective Student Ways To Give Alumni Online Intranet Full-Time M.B.A. Part-Time M.B.A. Executive M.B.A. M.S. Programs ... Simon Home You are at... The Simon School offers a comprehensive array of programs that allows students to receive a first-rate business education tailored to their specific needs. In addition to the Full- and Part-Time M.B.A. Programs, several other opportunities are available to students who wish to pursue coursework within a more specialized context of business management. These include the Joint- and Specialized-Degree Programs, M.S. Programs, a 3-2 M.B.A. Program, three Executive M.B.A. Programs (two in Europe) and a Ph.D. Program. The following is a list of the Joint- and Specialized-Degree Programs offered at the Simon School. Each specific entry includes a brief program description and contact details for further information. Anesthesiology/M.B.A. Program

A  B  C  D  E  F  G  H  I  J  K  L  M  N  O  P  Q  R  S  T  U  V  W  X  Y  Z

Page 8     141-160 of 173    Back | 1  | 2  | 3  | 4  | 5  | 6  | 7  | 8  | 9  | Next 20