61. MSCD The URL will be milwaukeescd.org . Moved, seconded and approved. B.The StahlConrad Homestead barn has been approved for mscd use. http://milwaukeescd.org/BoDminutes04-02.html

Board of Directors Meeting Minutes February 5, 2004 Present: Babin, Baker, P.Garragues, Gunderson, Hankes, McCormick, V. Phipps, R.Sinclair I. Call to order - 6:40 p.m. by President Babin II. Minutes were accepted as distributed III. Treasurer's report for 2003 was closed, budget for 2004 was prepared by the group. The membership dues were raised to $10.00 per year and a line item for yearly Web service was added. The treasurer will submit the completed budget to the web site. IV. Old Business A. Board members for the Nominating Committee members are Gunderson and R. Sinclair. Babin will appoint the rest of the Nominating Committee from the general membership. B. A non-profit status for the group will not be pursued further, there is no need. C. The amended by laws were approved by the board and will be posted on the web site for the general membership. Vote will be held at the general meeting, only paid members may vote. V. New Business A. Gunderson will no longer have access to free host space for a web site. The decision was made to purchase web space on Yahoo, using a URL from another source. The cost will be approximately $5.00 per month plus the nominal cost of the vanity URL. The URL will be "milwaukeescd.org". Moved, seconded and approved. B. The Stahl-Conrad Homestead barn has been approved for MSCD use. The in kind contribution from MSCD will be "housecleaning" and removing the current partitions from the main chamber. Volunteers will be solicited at the next Monday night class.

62. MSCD Dorcas 4x32R 4C S mscd Romance Culla Bay 4x32S 4C Sq 412 Mrs. Stewart sJig 8x32J 3C 351 Reel of the Royal Scots 8x32R 3C Leaflet 7. http://milwaukeescd.org/program04-05.html

Spring Dance Party Saturday, May 15, 2004 2:00 p.m. $10.00 admission NOTE: Recorded music will be used. The DeKoven Center Gymnasium 600 21st Street Racine, Wisconsin Information Potluck dinner and pool party to follow! Program Hooper's Jig 8x32J 3C Misc II Culla Bay 4x32S 4C Sq 41:2 Mrs. Stewart's Jig 8x32J 3C 35:1 Reel of the Royal Scots 8x32R 3C Leaflet #7 # Red House 8x40R 2C 7:2 Argyl Strathspey 8x32S 3C 35:3 Follow Me Home 8x32J 3C 38:3 Anniversary Reel 4x32R 4C S 36:7 Miss Milligan's Strathspey 8x32S 3C Leaflet #20 Waverly 8x48J 3C 15:12 Neidpath Castle 3x32S 3C S 22:9 Pelorus Jack 8x32J 3C Dolphin Book Glasgow Country Dance 8x16S+16R 3C 23:6 The Deil Amang the Tailors 8x32R 3C 14:7 EXTRA Mairi's Wedding 8x40R 3C Cosh 22 SCD Dances denoted with the pound symbol ( ) are difficult, new or unusual and are for those who have successfully danced them before. The cheat sheet, in MS Word or WordPad format, is available

63. MSCD Social Work Program information.. mscd s Social Work Department was granted initial accreditationby the Council on Social Work Education in February, 1997. http://www.developmentaldisability.org/mscd_social_work_programs.htm

Videos Faculty Advising Admission to the Department Required Non-Social Work Courses ... Colorado State Licensure Instructor, Larry Botnick, Honored At Convocation Larry is the one on the right! :-) At Fall Convocation (August 28, 2003), Distinguished Service Awards and Golden Key Faculty Awards were presented and Emeritus recipients were recognized. Our own Larry Botnick received the Adjunct Faculty Recognition Award The award reads: Larry Botnick has been a Metro State adjunct faculty member for the past three years. As manager of outpatient aftercare and Latino services at Adams County Mental Health, Botnick brings the outside world into the classroom. He has converted three courses in social work to online offerings, and his technological skills, including Powerpoint and use of Web-based materials, enhance his on-campus courses as well. Botnick is also known for working individually with at-risk students to increase their chances of success in a college environment. Join the Social Work Department List Serves!

64. MSCD Web supplement for the paper Differential Gene Expression Profiling of Adult MurineHematopoietic Stem Cells by InKyung Park, Yaqin He, Fangming Lin, Ole D http://db.systemsbiology.net/projects/local/stem_cell/

Web supplement for the paper " Differential Gene Expression Profiling of Adult Murine Hematopoietic Stem Cells " by: In-Kyung Park, Yaqin He, Fangming Lin, Ole D. Laerum, Qiang Tian, Roger Bumgarner, Christopher A. Klug, Kaijun Li, Christian Kuhr,Michelle J. Doyle, Tao Xie, Michel Schummer, Yu Sun, Adam Goldsmith, Michael F. Clarke, Irving L. Weissman, Leroy Hood, and Linheng Li Introduction: Method: Query: Click here to get full list of all the sequence. (Please contact Dr. Qiang Tian for the access code to open it.) By ID of the clone: Example: BA1A_21 (BA could be omitted) By txt (keyword) in the description of five best blast hits: Example: kinase By txt (sequence) in database : Example: Query="CGGCGGCAGCTCTGGCAAAGCAGCTGGAGATGAGACGTGTGCTAAGGTTGAGCGAGCTGA" Contact info: For questions related to the paper: Linheng Li , Ph.D. Assistant Stowers Scientist Stowers Institute For Medical Research lil@stowers-institute.org Or: Qiang Tian , M.D., Ph.D. Stem Cell Group The Institute For Systems Biology qtian@systemsbiology.org

65. Metro State College Login - Powered By Campus Pipeline http://metroconnect.mscd.edu/cp/home/loginf

66. Click Here If This Page Does Not Refresh To The Login Screen In 5 Click here if this page does not refresh to the login screen in 5 seconds. http://metroconnect.mscd.edu/

67. Caplan's Usage Stats:Last 100 Connections From Host: .client.mscd.edu Last 100 Connections From Host .client.mscd.edu. Date/Time, Hostname, Page, Browser.05/13/104 153158, ADMIN01BE.client.mscd.edu, . E103 Syl, Mozilla/4.0. http://www.bcaplan.com/cgi/pagelog.cgi?=,.client.mscd.edu,=,=,=

68. MSCD CHEERS mscd CHEERS. The 14member squad is coached by new head coach Brianna Newland. Comejoin us help cheer on mscd s sports teams this year. We love your support! http://www.fortunecity.com/olympia/dimaggio/60/

var TlxPgNm='index'; MSCD CHEERS * Metro State Home Page Check out EVENTS for tryout info ****THIS SITE IS STILL UNDER CONSTRUCTION **** Welcome to the Metropolitan State College of Denver Cheerleading web site. The Metro State Cheerleaders perform at all men's and women's basketball games throughout the year. The 14-member squad is coached by new head coach Brianna Newland Come join us help cheer on MSCD's sports teams this year. We love your support! About Us Tryouts Squads Pics ... Links ****THIS SITE IS STILL UNDER CONSTRUCTION ****

69. [ColoSPIN] Software Development Management - MSCD Course - Spring 2004 ColoSPIN Software Development Management mscd Course - Spring2004. Dr. Jody Paul jody at acm.org Wed Dec 17 155438 MST 2003 http://www.colospin.org/pipermail/colospin/2003-December/000032.html

[ColoSPIN] Software Development Management - MSCD Course - Spring 2004 Dr. Jody Paul jody at acm.org Wed Dec 17 15:54:38 MST 2003 Previous message: [ColoSPIN] ICCBSS 2004 - Early Registration Deadline Extended Messages sorted by: [ date ] [ thread ] [ subject ] [ author ] Software Development Management course at MSCD Spring 2004 - Professional Development* CSI 4282 - Software Development Management This course provides exposure to the principles and practices affecting the success and failure of software development efforts and the productivity of teams involved in such efforts. Target audience includes managers, team leads, and developers who are considering taking on leadership roles. (3 Credits) Tuesday evenings, 7:00-9:40PM; January 20 - May 4, 2004 Auraria Campus (Denver) For additional information please contact: Dr. Jody Paul Department of Mathematical and Computer Sciences Metropolitan State College of Denver jody at cs.mscd.edu For enrollment information please contact: MetroTech Advisor metrotech at mscd.edu

70. [ColoSPIN] (Late) FYI - Software Requirements Engineering For Industry At MSCD T ColoSPIN (Late) FYI Software Requirements Engineering for Industry at mscdthis Fall. Dr. Jody Paul jody at acm.org Mon Aug 18 162502 MDT 2003 http://www.colospin.org/pipermail/colospin/2003-August/000002.html

[ColoSPIN] (Late) FYI - Software Requirements Engineering for Industry at MSCD this Fall Dr. Jody Paul jody at acm.org Mon Aug 18 16:25:02 MDT 2003 Previous message: [ColoSPIN] "Intro to CMMI" course registration deadline is this Friday Next message: [ColoSPIN] CU-Denver Java Programming Leading Toward Sun Certification Course Messages sorted by: [ date ] [ thread ] [ subject ] [ author ] ... metrotech at mscd.edu For additional information please contact: Dr. Jody Paul jody at computer.org jody at computer.org To apply, call 303-352-4292 or send e-mail to metrotech at mscd.edu Previous message: [ColoSPIN] "Intro to CMMI" course registration deadline is this Friday Next message: [ColoSPIN] CU-Denver Java Programming Leading Toward Sun Certification Course Messages sorted by: [ date ] [ thread ] [ subject ] [ author ] ... More information about the ColoSPIN mailing list

71. Visual Basic Distributed (MSCD Exam Cram) M Thomas Visual Basic Distributed (mscd Exam Cram) M Thomas. Author or Artist M Thomas. Title Visual Basic Distributed (mscd Exam Cram) Thomas http://www.hjgains.co.uk/M-Thomas-Visual-Basic-Distributed-215-651-329-5.html

Visual Basic Distributed (MSCD Exam Cram) M Thomas Author or Artist : M Thomas Title: Visual Basic Distributed (MSCD Exam Cram) Thomas M M. Thomas Subject: Basic (Programming Language) Category: Special Features Used Books Computers Internet Programming Languages Tools Format: Paperback I. Rudenko-CISCO Routers for IP Routing (Little Black Book)... Ian Turek-MCSE SMS 2 Exam Cram... D. Kelly-Digital Compositing in Depth... Home ... Rebecca Brandewyne-Glory Seekers...

72. MSCD Unit Members Graduated in 1994. Obtained her Ph.D. in the mscd in 2000 on the roleof caspases and mitochondria in apoptotic and necrotic cell death. http://www.dmb.rug.ac.be/u3/people/

Molecular Signaling and Cell Death Group Leader Prof. Peter Vandenabeele , Ph.D. Secretary Veronique Vandevoorde , Ph.D. Postdoctoral Researchers Wim Declercq , Ph.D. Geertrui Denecker , Ph.D. Kathleen Dhondt , Ph.D. Saskia Lippens , Ph.D. Xavier Saelens , Ph.D. Ph.D. Students Dieter Demon Bart Depuydt Nele Festjens Dmitri Krysko ... Maria Francisca Van Gurp Technicians Wilma Burm Jill Demeulemeester Ann Meeus Master Level Students (Supervisor) Esther Hoste Group Leader Prof. Peter V andenabeele , Ph.D. Group leader of the Molecular Signaling and Cell Death Unit History Contact tel: +32 (0)9/33 13 760 e-mail: Peter.Vandenabeele@dmbr.UGent.be Postdoctoral Researchers : Wim Declercq , Ph.D. Major research topics Caspase-14 History Contact tel: +32 (0)9/33 13 735 e-mail: Wim.Declercq@dmbr.UGent.be Geertrui DENECKER Ph.D. Graduated in 1994. Obtained her Ph.D. in the MSCD in 2000 on the role of caspases and mitochondria in apoptotic and necrotic cell death.

73. Urgent - MSCD/MCAD Trainers - London Urgent mscd/MCAD Trainers - London at Rullion Computer PersonnelLtd in London, Mid Career Urgent - mscd/MCAD Trainers - London. http://technology.monster-jobs.co.uk/London/Urgent_-_MSCD_MCAD_Trainers_-_London

74. Office Of Student Activities Global Leadership Series, Office of Student Activities • Tivoli 305• 303.556.2595 • online@studentactivities.mscd.edu Site Meter. http://studentactivities.mscd.edu/

Metro Student Activities Get Involved Learn More QuickLinks Student Organization Listing Multi-Cultural Calendar Global Leadership Series online@studentactivities.mscd.edu var site="s10studentactivities"

75. Richard J. Lazzara, DMD, MScD Richard J. Lazzara, DMD, mscd, practises periodontics and implant dentistryin West Palm Beach, Florida. He has published a number http://www.boneengineering.com/author_bios/lazzara.html

Richard J. Lazzara, DMD, MScD, practises periodontics and implant dentistry in West Palm Beach, Florida. He has published a number of articles and textbook chapters on the subject of osseointegrated implants. His research topics cover a variety of areas, including regenerative, restorative, and early loading protocols. Recently, his focus has been the clinical benefits of the changing therapeutic protocols as a result of bioengineered surface technology. Lazzara is clinical assistant professor at the University of Southern California School of Dentistry, associate clinical professor at the University of Maryland's Periodontal and Implant Regenerative Center, and associate professor at the University of Miami. He has lectured extensively throughout the United States and internationally on the surgical and prosthetic application of implant dentistry. Book Chapters Author Bios Sponsors Order Book ... Site Search

76. VIDEOTRACKCDS - AUDIOs A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T. U. V. W. X.Y. Z. LAMHA PANKAJ UDHAS mscd378 , LAT JEE ALBUM 4 mscd-031 , LATAJEE ALBUM 2 mscd-06 . http://www.videotrackcd.com/asp/alphaaudiocds1.asp?alpha=L

77. VIDEOTRACKCDS - AUDIOs A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T. U. V. W. X. Y.Z. V CHANNEL CHART 33 mscd396 , V CHANNEL CHART 34 mscd-410 , V CHANELCHART 10 mscd-133 . http://www.videotrackcd.com/asp/alphaaudiocds1.asp?alpha=V

78. MSCD Practicum Materials why they wish to enter the program and how the program can lead to career successand three letters of recommendation to the mscd Graduate Coordinator. II. http://ntweb.deltastate.edu/vp_academic/jgreen/MSCD_Program/MSCD_Program.htm

HOME HOME HOME HOME Master of Science Degree in Community Development The Master of Science Degree in Community Development is designed to prepare graduates for successful careers as professional practitioners in private and public sector community organizations. The 36 hour graduate program draws from a broad range of educators with strong academic backgrounds and sufficient breadth of experience to provide sound educational experiences for students interested in community and economic development, including public, private, and non-profit organizations. The program provides both classroom and field experience. The program invites applicants from the Mississippi Delta region, from across the nation and around the globe. The program welcomes professionals who are working in community development and wish to enhance their technical skills and theoretical knowledge. Students may be full-time or part-time. I. Admission Requirements: An undergraduate degree in the proposed area of study or a related area. A minimum overall undergraduate grade point average of 3.0 with a 3.0 minimum on all major and other relevant coursework completed during the applicant's last 64 undergraduate hours.

79. TOCCATA : The Source To Classical Experience New, Link, Name, Price. mscd101, The Sounds of Prehistoric Scandinavia - Instrumentsfrom the Stone Age to the Viking Period, 132 kr. mscd-103, The Historia of St. http://www.toccata.nu/cd-label/sveciae/

Musica Sveciae [Up to date inhouse stock ] New Link Name Price MSCD-101 The Sounds of Prehistoric Scandinavia - Instruments from the Stone Age to the Viking Period 132 kr MSCD-102 Gregorian music - Glory of the Saints 151 kr MSCD-103 The Historia of St. Erik 132 kr MSCD-201 Piae Cantiones 132 kr MSCD-202 Vasakungarnas Hov 132 kr MSCD-301 151 kr MSCD-302 Johann Valentin Meder - Music across the Baltic 132 kr MSCD-303 Schmezer, Georg - Virtue and Glory 132 kr MSCD-304 Joyful Song and Gleeful Dance - Uppsala Cathedral Boy's Choir 132 kr MSCD-305 Gustavus Rex and Christina Regina 132 kr MSCD-306 / 307 Music at the Royal Palace 260 kr MSCD-401 Then Svenska Messan (The Swedish Mass) 151 kr MSCD-402 Wikmanson - String Quartets 151 kr MSCD-404 Roman - Festive Music for Count Golovin 132 kr MSCD-405 Roman - Solo Concertos 132 kr MSCD-406 Roman - Sonatas and Assaggi 132 kr MSCD-407 Gustavian Composers 132 kr MSCD-408 Roman - Trio Sonatas 132 kr MSCD-410 Drottningholmsmusiken (The Royal Wedding Music of Drottningholm) 132 kr MSCD-411 Solo Concertos 132 kr MSCD-412 Music form the Age of Liberty 132 kr MSCD-413 Roman - Cantats 132 kr MSCD-414 Kraus - String Quartets 132 kr MSCD-415 Kraus - Chamber Music 132 kr MSCD-416 Kraus - Funeral Music for Gustav III 132 kr MSCD-417 Roman - Lilla Drottningholmsmusiken 151 kr MSCD-418 Roman - Sinfonia 132 kr MSCD-419 Kraus - Sinfonia 132 kr MSCD-420 / 421 Bellman - Songs and Epistles 260 kr MSCD-422 / 423 Kraus - Proserpin (opera in one act)

80. Toccata Music Shop - Inhouse Stock - Musica Sveciae Go to index Nr. Title. mscd 103, Erik den Heligas Hystoria. mscd 201, Pia Cantiones.mscd 302, Music across the Baltic. mscd 303, Schmezer, Georg Virtue and Glory. http://www.toccata.nu/cd-label/musica_sveciae-stock.html

What's in stock for instant delivery? Arcana Avie Records Aurehl Production Audite ... Various Inhouse stock by 6th of April 2004 - Musica Sveciae Go to index Nr. Title MSCD 103 Erik den Heligas Hystoria MSCD 201 Pia Cantiones ... Webmaster C: Toccata 2004

Page 4     61-80 of 107    Back | 1  | 2  | 3  | 4  | 5  | 6  | Next 20