Lyme Disease, Division Of Microbiology And Infectious Diseases The National Institutes of Health (NIH), National Institute of Allergies and Infectious Diseases (NIAID), Division of microbiology and Infectious Diseases (DMID) presents information on Lyme disease in the following categories Introduction, Extramural Research Projects and Clinical Studies, Conference Proceedings, Brochures, News Releases, Fact Sheets, Research Plans and Priorities, Opportunities and Resources, Intramural Research Projects, Meetings. http://www.niaid.nih.gov/dmid/lyme/
Extractions: Related Links Lyme disease is an infection caused by the corkscrew-shaped bacteria Borrelia burgdorferi that are transmitted by the bite of deer ticks (Ixodes scapularis) and western black-legged ticks (Ixodes pacificus). The deer tick, which normally feeds on the white-footed mouse, the white-tailed deer, other mammals, and birds, is responsible for transmitting Lyme disease bacteria to humans in the northeastern and north-central United States. On the Pacific Coast, the bacteria are transmitted to humans by the western black-legged tick. Top of Page Extramural Research Projects and Clinical Studies NIH Chronic Lyme Disease Treatment Study Protocol , (Phase III Clinical Study) Seronegative Chronic Lyme Disease , (Phase III Clinical Study) Seropositive Chronic Lyme Disease , (Phase III Clinical Study) NIAID's Chronic Lyme Disease Study: Questions and Answers Reliability of Blood and Urine Tests for Lyme Disease Lyme Disease Advisory Panel Summary Report (Sept. 4, 1996)
Inter-Research - Marine Ecology Progress Series serves as a worldwide forum for all aspects of marine ecology, fundamental and applied. The journal covers microbiology, botany, zoology, ecosystem research, biological oceanography, ecological aspects of fisheries and aquaculture, pollution, environmental protection, conservation, resource management. Published by John Wiley Sons. http://www.int-res.com/journals/meps/index.html
Welcome To The Department Of Microbiology The faculty of the Department of microbiology carry out multidisciplinary research programs in microbial genetics, pathogenesis, immunology, and virology. http://www.microbio.uab.edu/
Extractions: The faculty of the Department of Microbiology carry out multi-disciplinary research programs in microbial genetics, pathogenesis, immunology, and virology. The Department of Microbiology has 41 primary faculty and $16 million in active NIH grant support. It is one of eight Joint Health Science Departments at UAB. Departmental dedication to excellence in research, teaching, and training is evidenced not only by our funding support, but also by our ability to attract outstanding postdoctoral fellows and graduate students. We train approximately thirty postdoctoral and seventy-five graduate students at any given time and take pride in launching our trainees into successful and productive careers.
Department Of Microbiology And Immunology The Department of microbiology and Immunology at The UND School of Medicine and Health Sciences welcomes you to our home page. Please http://www.med.und.nodak.edu/bimd/micro.html
Extractions: text only The Department of Microbiology and Immunology at The UND School of Medicine and Health Sciences welcomes you to our home page. Please follow the links above or to the left to find out more about our department, the Medical School at UND, or Grand Forks. Feel free to contact us if you have any questions. DEPARTMENT
Extractions: Search The Web Member Central Join Our Community! Login What's New Become a SuiteU Affiliate ... MemberUpdate Suite University About Suite University Suite University News Visit the University Course Listing ... FREE Demo Course New Topics SpiritWell Travel Book Reviews Agora News Foraging Wild Foods ... More... Suite Events Teacher Appreciation Event 2004 Family Focus 2004 In Tune With Johann Sebastian Bach More about Suite101 About Suite101.com Advertise With Suite For more information - Select a related topic - Aquatic Animals Arctic Wildlife Backyard Birdwatching Alm Birding Ecology Living With Nature Living with Wildlife Lizards, Turtles and Snak Massachusetts Natural His Microbiology Natural Horsemanship Paleontology Science of the Sky Snails and Shells Water for Life Wild Cats Wildlife Wildlife News and Humor
Brazilian Journal Of Microbiology - Home Page Translate this page Brasileira de Microbiologia Mission To publish original research papers, research notes and, occasionally, reviews, covering all aspects of microbiology. http://www.scielo.br/scielo.php?script=sci_serial&pid=1517-8382&lng=en&nrm=iso
Weiterleitung covers the entire field of marine botany including marine microbiology and marine mycology. Its purpose is to disseminate original knowledge, to provide synopses of global or interdisciplinary interest, and to stress aspects of utilization. Published by Walter de Gruyter. http://www.degruyter.de/journals/bm/index.html
Journal Of Medical Microbiology -- Home Society for General microbiology HighWire Press The Society for General microbiology publishes Journal of Medical microbiology Online with the assistance of http://jmm.sgmjournals.org/
CELLS Alive! Good general microbiology information, with images and videos. http://www.cellsalive.com/
Extractions: (Return to Main) CONSERVED CIS-ACTING SEQUENCES OF RNA VIRUSES Single-stranded, minus-sense RNA genome Sequences shown here are those of the genomic minus-strand RNA e.g. , Marburg virus (MBG) , Ebola virus (EBO). [e.g., Kiley, et al., 1986 5' end 3' end Marburg (Musoke) GGACACACAAAAAAGAUGAAGAA...AUCAUCUCUUGUUUUUGUGUGUCU MVREPCYC Z12132 Ebola (Mayinga) UA-AU-...UC-UCUCCG 5' and 3' ends are invert repeats, that potentially form panhandle structures, probably recognized for replication, transcription or packaging. e.g., Marburg virus: 5' end GGACACACA AAAAA GAUGAAGAAUGUUUUGUGUUACUUAUAUCAAAGCU_ MVREPCYC Z12132 5' end 3' end Sendai ACC AGACAAGAGUUUAAGA.....UUUUUCUCUUGUUU GGU PAFZSTR M30202 VSV GAC-C-AAACC-.....-GGUGUC-UC VSVCG J02428 MBG GGAC-C-AA-AGAUG-AG.....-CGU-UG-GUC-
RSSL Science With Service Research, analysis and consultancy for the food, drink and consumer goods industries including microbiology, vitamin analysis, natural products, chemical testing and GMOs. http://www.rssl.com/
Extractions: Parents report that colours and preservatives do affect children Numerous UK media sources report on work carried out by scientists at the University of Southampton, under the leadership of Professor John Warner. They appear to confirm the notion that certain artificial colours and the preservative, more... RSSL is an independent global leader at the forefront of scientific analysis, product testing, product development, training and consultancy. We serve the food, pharmaceutical, and consumer goods industries. We offer industry leading customer service coupled with scientific excellence. Health, obesity and well-being (HOW) service RSSL has launched a range of services that are designed to tackle many of the consumer health, obesity and well-being (HOW) issues that are currently at the forefront of the food industry. The HOW package of services includes glycemic index (GI) testing of foods and reformulation of products to achieve a lower GI. The services are designed to give manufacturers the opportunity to provide consumers with the healthiest possible version of any product.
Extractions: Staphylococcus aureus For the Water Treatment Industry: All water microbiology for drinking water standards and EC Directives. Microbiology testing, bacteria testing of potable water supplies and other waters including cooling towers. Total Viable Counts, TVCs, plus Coliforms and E.coli by membrane filtration. Swimming pools, spa pools, jacuzzi also tested for Pseudomonas, faecal streptococci,Clostridium perfringens. Legionella testing and legionella risk assessment performed. Dip slides supplied. Environmental Testing: Hygiene testing, hygiene consultancy, environmental swabs, settle plates, slit sampling for air microbiology also available.
Microbiology Textbook :: The World Of Microbes Timothy Paustian from the University of WisconsinMadison has created an excellent microbiology textbook. http://www.bact.wisc.edu/microtextbook/index.html
Extractions: Science News Malaria has been eradicated from the United States, but is still common in other parts of the world. Due to socio-economic conditions, health care and mosquito control, it is unlikely it would reestablish itself in this country. However, about 60 cases of imported malaria occur in Florida each year and the possibility exists for local transmission. The CDC and local health departments in the Florida region are always on the lookout for this possibility and a recent report demonstrates the methodologies employed in tracking cases down.
The Ebola And Marburg Virus Includes Genomic Structure, Comparative and Molecular Biology http://www.uct.ac.za/microbiology/ebolagen.html
Extractions: Graduate Studies Homepage The Graduate Program in Immunology, Microbiology and Vaccine Biology is an integrated graduate program that provides predoctoral training and Ph.D. research opportunities in the areas of Immunology, Microbiology and Vaccine Biology. This graduate program is based at the University of Rochester Medical Center (Rochester, New York) and it is administered principally by faculty from the Department of Microbiology and Immunology and the Center for Vaccine Biology and Immunology . Other participating Departments and Centers include the Departments of Biochemistry and Biophysics, Chemical Engineering, Dermatology, Medicine, Obstetrics and Gynecology, Pediatrics and Psychiatry, the Center for Oral Biology and the University of Rochester Cancer Center. This doctoral program seeks to provide an outstanding training environment for the predoctoral education of the next generation of immunologists and microbiologists who will be working in academic institutions, industry, government laboratories and private research foundations. This environment includes: outstanding Ph.D. research opportunities; concerned, skilled, and interactive research mentors whose research addresses a wide diversity of scientific questions; state-of-the art research facilities; newly redesigned graduate level lecture courses; advanced topical seminars; and opportunities to attend and actively participate in scientific meetings providing a wide range of faculty expertise and research opportunities.
Bugs In The News! John (Jack) C. Brown from the University of Kansas, Lawrence, Kansas has created great microbiology site. It contains a What the Heck is ? , a general interest, and other bug bytes sections. Good information. http://people.ku.edu/~jbrown/bugs.html
Extractions: Don't Touch That Doorknob! How Germs Can Zap You and How You Can Zap Back , Warner Books, Publisher, publication date, October 1, 2001 was written by me and Edited by Dinah Dunn of Byron Preiss Visual Publications, New York and Jackie Merri Meyer of Warner Books. Available on-line and at bookstores, the book provides information on microorganisms associated with foodborne illness, colds and flu, day care, hospitals, travel, pets, home, work and those that may be used as an agent for biological warfare. All of the "Feature Articles," and the articles in "What the Heck is...?" and in "General Interest" were written by me, and therefore, any mistakes are mine, alone. I have tried to be as accurate as possible within the limits of providing the information in a "reader-friendly" format. Therefore, please forgive any latitude I have taken with the pure science discussed. With these caveats in mind: in keeping with the spirit of the "Web" and Internet, and the fact that this institution has been established for, and is devoted to, learning, all of the articles on these Pages are for anyone's use, as long as the use is for non-profit only, and this statement accompanies any copies.
Undergraduate Program In Biology And Medicine For undergraduate students, degree concentrations include biochemistry, biology, cell and developmental biology, ecology and evolutionary biology, microbiology, molecular genetics, and neuroscience. http://www.rochester.edu/College/BIO/UPBM/index.html
Extractions: A collaborative effort between the College of Arts and Sciences and the School of Medicine and Dentistry for undergraduate education in the Biological Sciences. An exciting program in the Biological Sciences is available to undergraduate students at the University of Rochester. The Program combines the College of Arts and Sciences and the School of Medicine and Dentistry to provide courses for undergraduate students with lectures, laboratory work, specialty seminars and research experiences. The Program provides academic year opportunities to do independent research for credit as well as DeKiewiet Summer Fellowships which support summer research by outstanding University of Rochester undergraduate students. The Program is made possible by the close proximity of the Medical Center and the River Campus and by the enthusiasm of the faculty for cooperative teaching aimed at providing the most up-to-date education in biomedical science. Last modified: November 15, 2001.
Joint & Specialized Degree Programs The Simon School offers a variety of specialized degrees in conjunction with the Department of Anesthesiology, the Department of microbiology and Immunology, the School of Nursing, the Department of Community and Preventive Medicine, and the M.D. Program at the School of Medicine and Dentistry. http://www.ssb.rochester.edu/programs/program_joint.aspx
Extractions: - Quick Links - About Simon Full-Time M.B.A. Part-Time M.B.A. Executive M.B.A. MS Programs Certificate Program Ph.D. Programs Corporate Partners Faculty Research Accepted Students Prospective Student Ways To Give Alumni Online Intranet You are at... The Simon School offers a comprehensive array of programs that allows students to receive a first-rate business education tailored to their specific needs. In addition to the Full- and Part-Time M.B.A. Programs, several other opportunities are available to students who wish to pursue coursework within a more specialized context of business management. These include the Joint- and Specialized-Degree Programs, M.S. Programs, a 3-2 M.B.A. Program, three Executive M.B.A. Programs (two in Europe) and a Ph.D. Program. The following is a list of the Joint- and Specialized-Degree Programs offered at the Simon School. Each specific entry includes a brief program description and contact details for further information. Anesthesiology/M.B.A. Program
