Home  - Biology - Human Genomics

Books Baby Camera Phones Computers Games DVD Electronics Kitchen Magazines Music Garden Software Tools Toys Video Apparel & Accessories Jewelry & Watches Musical Instruments Health & Personal Care Beauty Sports & Outdoors Office Products

e99.com Bookstore

Images

Newsgroups

101-114 of 114    Back | 1  | 2  | 3  | 4  | 5  | 6

Human Genomics:     more books (99)

Statistics in Human Genetics and Molecular Biology (Chapman & Hall/CRC Texts in Statistical Science) by Cavan Reilly, 2009-06-19 Integrative Physiology in the Proteomics and Post-Genomics Age Computational Genetics and Genomics: Tools for Understanding Disease Nutritional Genomics: The Impact of Dietary Regulation of Gene Function on Human Disease Seeking genetic fate: personal genomics companies offer forecasts of disease risk, but the science behind the packaging is still evolving.: An article from: Science News by Patrick Barry, 2009-07-04 Handbook of Genomics and the Family: Psychosocial Context for Children and Adolescents (Issues in Clinical Child Psychology) Genomic Imprinting: Methods and Protocols (Methods in Molecular Biology) Mutants: On Genetic Variety and the Human Body by Armand Marie Leroi, 2003-11-10 Pathogen Genomics: Impact on Human Health --2002 publication. by various, 2002-01-01 Genome Project: Science, Genome, Organism, Animal, Plant, Fungus, Bacteria, Protist, Virus, Chromosome, Human Genome Project, Genomics, List of sequenced archaeal genomes Human Origins: What Bones and Genomes Tell Us about Ourselves by Dr. Rob DeSalle, Ian Tattersall, 2008-03-18 Genomic signatures of human versus avian influenza A viruses.(RESEARCH): An article from: Emerging Infectious Diseases by Guaung-Wu Chen, Shih-Cheng Chang, et all 2006-09-01 Genomics by Philip Benfey, 2004-10-28 Essentials of Genomics by Philip Benfey, 2004-10-28

lists with details

101. Human Genome Project History
     human Genome Project (HGP) History (a personal account). The HGP began DOElaunched its human Genome Initiative in 1986. The OHER Research  
     http://arep.med.harvard.edu/gmc/HGP.html

102. Africa Human Genome Initiative
     Africa human Genome Initiative, The human genome project. The Africahuman Genome Initiative was established to address these concerns.  
     http://www.hsrc.ac.za/genome/
     
     Extractions: Who We Are Organisational Diagram Contact Us 2003 HSRC Institutional Review ... Occasional Papers About Us Research Programmes Publishing Media Search Staff Contact Us Site Map ... Genome home / Human Sciences Research Council - Genome Home News News Archive FAQ Reading Events Introduction Event Papers Genome Art Profiles ... Genome Links Africa Human Genome Initiative The human genome project is an international research program designed to construct detailed genetic and physical maps of the estimated 50 000-100 000 genes within the human genome. It is one of the greatest scientific developments of our time, and is yielding results that will influence our understanding of human biology and evolutionary history. Africa runs the risk of marginalisation from this exciting and innovative research. Perhaps more worrying, an uninformed population risks commercial and ethical exploitation. African states cannot afford to be mere observers.

103. "The Human Genome Project: A Scientific And Ethical Overview" By Marion L. Carro
     The human Genome Project A Scientific and Ethical Overview by Marion L.Carroll, Ph.D., and Jay Ciaffa, Ph.D.  
     http://www.actionbioscience.org/genomic/carroll_ciaffa.html

104. Genetics Moves On
     Proteins first, genes second. The human Genome Project is decoding, letter byletter, the sequence of 3 billion nucleotide bases in the human genome.  
     http://whyfiles.org/075genome/
     
     Extractions: TCCCCCTGGAGTTTTCCATTAGTGAGTTTTTG Exciting, isn't it? This gibberish, a bit of genetic sequence, is nonetheless the biggest story in biology. The near-completion of the human genome the elaboration of what our DNA looks like at the molecular level was an epic story of scientific competition documented in this kind of impenetrable, repetitive string of A, C, G and T. It may be the book of life, but DNA, the two-stranded molecule that forms the pattern for the structure of almost every organism, reads as a simple and incredibly useful "sequence."

105. JGI - Human Genome Project
     Programs human Genome Project, Another project goal is to determine the completesequence of the 3 billion DNA subunits (bases in the human genome).  
     http://www.jgi.doe.gov/programs/hgp.html
     
     Extractions: Operated by The University of California for The US Department of Energy Programs: Human Genome Project The Human Genome Project (HGP) is an international 13-year effort formally begun in October 1990 to discover all the estimated 30,000-40,000 human genes and make them accessible for further biological study. Another project goal is to determine the complete sequence of the 3 billion DNA subunits (bases in the human genome). As part of the HGP, parallel studies are being carried out on selected model organisms such as the bacterium E. coli to help develop the technology and interpret human gene function. The DOE Human Genome Program and the NIH National Human Genome Research Institute (NHGRI) together make up the U.S. Human Genome Project. NEW!

106. The Institute For Genomic Research
     Comparing the rat to the human and mouse genomes, the Rat Genome Sequencing ProjectConsortium reported that nearly all human genes known to be associated with  
     http://www.tigr.org/
     
     Extractions: New Clone Sets Announced for Pathogen Researchers 05.17.2004 A new resource for pathogen investigators - the Invitrogen Gateway® Entry Clone Resource - is being offered by the NIAID-sponsored Pathogen Functional Genomics Resource Center (PFGRC) at TIGR. Beginning May 17, the PFGRC will make available clone sets from S. pneumoniae and B. anthracis that are produced using Invitrogen’s Gateway® Cloning Technology. In addition, the PFGRC is providing, at no cost to investigators, a custom clone ordering process which will allow them to specify and order up to 96 Invitrogen Gateway® Entry Clones at a time from a select group of microbial pathogens. A complete description of the available Invitrogen Gateway® Entry Clones and the ordering process can be found at the PFGRC web site: Please check the web site for updates >> Genome Properties, a new system for comparative genomics and whole-genome analysis released

107. Genome Projects - The Institute For Genomic Research
     engaged in a largescale BAC end sequencing project for human, Rat and Mouse BACends. Analysis of genetic variability, gene content, and genomic potential in  
     http://www.tigr.org/tdb/
     
     Extractions: Genome Projects TIGR's Genome Projects are a collection of curated databases containing DNA and protein sequence, gene expression, cellular role, protein family, and taxonomic data for microbes, plants and humans. Anonymous FTP access to sequence data is also provided. Please read the regarding use of data. The TIGR clone distribution policy is available for viewing. Comprehensive Microbial Resource (CMR) Containing analysis on world-wide completed microbial genome sequencing , including all TIGR's published organisms.

108. Logos: Practical Use Of Genome Information
     Putting human genome information to practical use. Sidebar Using computer WIT towin structural genome race. Putting human genome information to practical use.  
     http://www.anl.gov/OPA/logos18-2/genome1.htm
     
     Extractions: Argonne home page Feature articles Putting human genome information to practical use Sidebar: Using computer WIT to win structural genome race Rare Isotope Accelerator hurtles physics into world of extreme science Sidebar: Physicists seeking supernovae: trial run for new physics machine Chemists, material scientists have big questions about tiny particles Argonne Update Hermann A. Grunder named Argonne Director Putting human genome information to practical use by Evelyn Brown and Yolanda Lukaszewski By the time the news broke that the human genome had been mapped earlier this year, Argonne researchers were already hard at work turning laboratories into high-tech production lines to speed up the process of determining the structure of the genome's proteins. Thanks to new tools and techniques developed at Argonne, it now takes only days or weeks to determine a protein structure; a process that not too long ago it took months or years. ROBO-CLONES Christina Hueneke oversees a robot that produces 20 times as many protein clones as a traditional wet lab.

109. Ensembl Genome Browser
     Ensembl Genome Browser. Search Ensembl. Display your own data in Ensembl, EnsemblDAS. Apollo genome browser, Apollo genome browser. Questions or suggestions?  
     http://www.ensembl.org/
     
     Extractions: Ensembl Genome Browser Search Ensembl Search all species for Anything Disease Domain EST Family Gene MRNA Marker Peptide Protein QTL SNP SangerProject Sequence Unigene with About Ensembl Ensembl is a joint project between EMBL - EBI and the Sanger Institute to develop a software system which produces and maintains automatic annotation on metazoan genomes. Ensembl is primarily funded by the Wellcome Trust

110. Broad Institute
     News@Broad. Study identifies which patients can benefit from targetedlung cancer drug –– and why (05.06.2004); Sabeti Receives  
     http://www-genome.wi.mit.edu/

111. GenomeWeb - Lists Of Genome Sites
     Welcome to the GenomeWeb GenomeWeb Lists of Genome Sites. Search for If you thinkwe have missed something useful, please let us know. Genome Centres  
     http://www.rfcgr.mrc.ac.uk/GenomeWeb/

112. Online NewsHour: Breaking The Code -- December 2, 1999
     Yesterday, researchers yesterday, researchers involved in the international humangenome project announced that one chapter of the book was now essentially  
     http://www.pbs.org/newshour/bb/health/july-dec99/dna_12-2.html
     
     Extractions: Patient Privacy Browse the NewsHour's coverage of health. Nature University of Oklahoma National Institutes of Health SUSAN DENTZER: For nearly a decade, scientists have been attempting to decipher the so-called book of life, the sequence of billions of molecules of DNA that constitute humans' genetic makeup. Yesterday, researchers yesterday, researchers involved in the international human genome project announced that one chapter of the book was now essentially complete. Dr. Harold Varmus, director of the National Institutes of Health, described the accomplishment. DR. HAROLD VARMUS: As this chart indicates, there are, of the 24 volumes of the human encyclopedia that we mentioned earlier, chromosome 22, volume 22, is now filled in. In each of these volumes there are many chapters that tell us profound information about essentially the entire human body plan and the diseases that affect all those organs.

113. Mapping The Icelandic Genome
     Mapping the Icelandic Genome  
     http://sunsite.berkeley.edu/biotech/iceland/

114. Genomics:GTL Progam, U.S. Department Of Energy
     The next step at the Department of Energy to use data and resources from the HumanGenome Project to accelerate understanding of dynamic living systems.  
     http://doegenomestolife.org/
     
     Extractions: Human Genome Project Information Genomics:GTL Microbial Genome Program home breadCrumbs("www.doegenomestolife.org","","index.shtml","crumb","crumb","crumb","0"); Skip Navigation About Goals Benefits ... Home More News and Announcements T he revolution in biology triggered by the Human Genome Project now promises far-reaching benefits.

101-114 of 114    Back | 1  | 2  | 3  | 4  | 5  | 6